seqfu less

Screenshot of "seqfu less"

less is an interactive pager for FASTA/FASTQ files, inspired by Unix less. It provides a full-screen terminal interface for browsing sequences with colored bases, quality visualization, and oligo search highlighting.

Usage: less [options] <inputfile>

Interactive viewer for FASTA/FASTQ files (like Unix less for sequences).

Navigation:
  Up/Down, A/Z         Scroll one record up/down
  PgUp/PgDown          Scroll one page up/down
  Ctrl+A/Ctrl+Z        Jump 100 records up/down
  Home/End             Jump to start/end
  Left/Right           Scroll 1bp horizontally (no-wrap mode)
  L/K                  Scroll 25bp left/right
  Ctrl+L/Ctrl+K        Scroll 250bp left/right

Commands:
  /                    Search pattern (ID, comment, or oligo)
  :                    Jump to record number
  n/N                  Next/previous search match
  S                    Toggle line wrap
  T                    Cycle theme (Dark/Light/Solarized)
  R                    Toggle record numbers
  C                    Toggle compact FASTQ view
  U                    Toggle quality bars/characters
  0                    Toggle sequence base coloring
  H                    Show help
  Q, Esc               Quit

Options:
  -S, --no-line-wrap       Disable line wrapping [default: false]
  -c, --cache-size SIZE    Cache size [default: 1G]
  -m, --mouse              Enable mouse support
  -o, --oligo1 OLIGO       Highlight oligo (blue background)
  -r, --oligo2 OLIGO       Second oligo to highlight (red background)
  -q, --qual-scale STR     Quality thresholds [default: 3:15:25:28:30:35:40]
  --match-ths FLOAT        Oligo match threshold [default: 0.75]
  --min-matches INT        Oligo min matches [default: 5]
  --max-mismatches INT     Oligo max mismatches [default: 2]
  --ascii                  Use ASCII quality chars
  -Q, --qual-chars         Show quality characters instead of bars
  -n, --nocolor            Disable colors
  -h, --help               Show this help

Comparison with seqfu view

Feature seqfu view seqfu less
Output Prints to stdout Interactive TUI
Navigation Pipe to less -SR Built-in scrolling
Themes Single style 3 themes (Dark/Light/Solarized)
Search Command-line only Interactive / search
Line wrap Terminal dependent Toggle with S key

Use seqfu view when you want to pipe output or process it further. Use seqfu less for interactive exploration of sequence files.

Keyboard Navigation

Vertical Scrolling (Records)

Key Action
Up, A Scroll up one record
Down, Z Scroll down one record
PgUp Scroll up one page
PgDown Scroll down one page
Ctrl+A Jump 100 records up
Ctrl+Z Jump 100 records down
Home Jump to first record
End Jump to last record

Horizontal Scrolling (No-wrap mode)

Key Action
Left Scroll left 1 bp
Right Scroll right 1 bp
L Scroll left 25 bp
K Scroll right 25 bp
Ctrl+L Scroll left 250 bp
Ctrl+K Scroll right 250 bp
Key Action
/ Enter search mode
: Jump to record number
n Next search match
Shift+N Previous search match

Search modes

When you press / and enter a pattern:

  • Oligo search: If the pattern contains only IUPAC nucleotide characters (A, C, G, T, N, U, R, Y, S, W, K, M, B, D, H, V), it searches in sequences and highlights matches with a magenta background.

  • Text search: If the pattern contains other characters, it searches in sequence names and comments (case-insensitive) and highlights matches in the header.

Display Options

Key Action
S Toggle line wrap ON/OFF
T Cycle through themes
R Toggle record numbers
C Toggle compact FASTQ view (bases colored by quality)
U Toggle quality bars/characters
0 Toggle sequence base coloring ON/OFF
H Show help screen
Q, Esc Quit (or exit help)

Line Wrap Modes

Wrap ON (default)

Sequences wrap across multiple lines. For FASTQ files, each line of sequence is immediately followed by its corresponding quality line:

@sequence_name comment
ACGTACGTACGTACGTACGT
████████████████████
ACGTACGTACGT
████████████

Wrap OFF (-S or toggle with S)

Sequences display on a single line with horizontal scrolling. Use arrow keys or L/K to scroll left and right.

Themes

Three color themes are available, cycle through them with T:

  1. Dark (default): Light text on dark background
  2. Light: Dark text on light background
  3. Solarized: Solarized color palette

Color Legend

DNA Bases

Base Color
A Red
C Cyan
G Green
T/U Yellow
N White/Gray

Quality Scores

Quality scores are rendered as colored Unicode bars (or ASCII with --ascii):

  • Low quality (Q < 15): Red
  • Medium quality (Q 15-30): Yellow
  • High quality (Q > 30): Green

Compact FASTQ View

When compact view is enabled (C), bases are colored by their quality score instead of base identity:

  • Very low quality: Gray
  • Low quality: Red
  • Medium quality: Yellow
  • Good quality: Green

Highlighting

Match Type Background Color
Oligo 1 (-o) Blue
Oligo 2 (-r) Red
Search match Magenta

Examples

Basic usage

seqfu less sequences.fastq

With oligo highlighting

seqfu less -o ACGTACGT -r TGCATGCA sequences.fastq

Start without line wrap

seqfu less -S long_sequences.fasta

With mouse support

seqfu less -m sequences.fastq

Or set the environment variable:

export SEQFU_MOUSE=1
seqfu less sequences.fastq

Tips

Searching for primer binding sites

  1. Press / to enter search mode
  2. Type your primer sequence (e.g., ACGTACGT)
  3. Press Enter
  4. Use n and N to navigate between matches
  5. Matches are highlighted in magenta

Quickly jumping to a specific record

  1. Press : to enter jump mode
  2. Type the record number (1-based)
  3. Press Enter

Finding sequences by name

  1. Press / to enter search mode
  2. Type part of the sequence name (e.g., sample_001)
  3. Press Enter
  4. The matching text in the header will be highlighted

Unicode Support

The quality bars use Unicode block characters for graphical rendering. If your terminal doesn’t support Unicode, use --ascii for ASCII-only output, or --qual-chars to show the raw FASTQ quality characters.

Test Unicode support:

echo -e '\xe2\x82\xac'

If you see the Euro sign, your terminal supports Unicode.

See Also

  • seqfu view - Non-interactive sequence viewer
  • seqfu msa - Interactive multiple sequence alignment viewer