grep is one of the core subprograms of SeqFu.

It can be used to select sequences by their name, comments or sequence using IUPAC degenerate oligo as query.

Usage: grep [options] [<inputfile> ...]

Print sequences selected if they match patterns or contain oligonucleotides

Options:
  -n, --name STRING      String required in the sequence name
  -r, --regex PATTERN    Pattern to be matched in sequence name
  -c, --comment          Also search -n and -r in the comment
  -f, --full             The string or pattern covers the whole name
                         (mainly used without -c)
  -w, --word             The string or pattern is a whole word
                         (only effective with -c, as names do not contain spaces)
  -i, --ignore-case      Ignore case when matching names (is already enabled with regexes)
  -o, --oligo IUPAC      Oligonucleotide required in the sequence,
                         using ambiguous bases and reverse complement
  -A, --append-pos       Append matching positions to the sequence comment
  --max-mismatches INT   Maximum mismatches allowed [default: 0]
  --min-matches INT      Minimum number of matches [default: oligo-length]
  -v, --verbose          Verbose output
  --help                 Show this help

Get sequences by name

In a sequence the name, or id, is the string before the first white space character, while we define as comment all the rest:

>Seq_Name_Here  after the name or ID, everything else is the comment
ATTACAAACAGTCGATCGTAGCTAGCTAGCTGATC

To extract all the sequences containing “Here” in the name:

seqfu grep -n Here file.fasta

If we also want to extend the search to comments we need to add the -c (or --comment) switch:

seqfu grep -c -n extend file.fasta

Finally, regular expressions are supported only enabling -r (or --regex):

seqfu grep -r -n Seq_N..._ file.fasta

Matching patterns in DNA sequences

A simple text search (even with regular expressions) cannot be a handy way to identify matches in a DNA/RNA sequence.

Using the -o (--oligo) parameter, we scan the sequence for matches of oligonucleotides supporting IUPAC degenerate bases, supporting reverse complement matches and partial matches.

>Example
CAGATAAAA

if we scan for TTTT we will match the sequence, as it’s in the reverse complement strand:

seqfu grep -o TTTT file.fasta

We can also use IUPAC bases (N for any base, B for C, G or A…):

seqfu grep -o TTTTNT file.fasta

Screenshot