seqfu grep
grep is one of the core subprograms of SeqFu.
It can be used to select sequences by their name, comments or sequence using IUPAC degenerate oligo as query.
Usage: grep [options] [<inputfile> ...]
Print sequences selected if they match patterns or contain oligonucleotides
Options:
-n, --name STRING String required in the sequence name
-r, --regex PATTERN Pattern to be matched in sequence name
-c, --comment Also search -n and -r in the comment
-f, --full The string or pattern covers the whole name
(mainly used without -c)
-w, --word The string or pattern is a whole word
(only effective with -c, as names do not contain spaces)
-i, --ignore-case Ignore case when matching names (is already enabled with regexes)
-o, --oligo IUPAC Oligonucleotide required in the sequence,
using ambiguous bases and reverse complement
-A, --append-pos Append matching positions to the sequence comment
--max-mismatches INT Maximum mismatches allowed [default: 0]
--min-matches INT Minimum number of matches [default: oligo-length]
-v, --verbose Verbose output
--help Show this help
Get sequences by name
In a sequence the name, or id, is the string before the first white space character, while we define as comment all the rest:
>Seq_Name_Here after the name or ID, everything else is the comment
ATTACAAACAGTCGATCGTAGCTAGCTAGCTGATC
To extract all the sequences containing “Here” in the name:
seqfu grep -n Here file.fasta
If we also want to extend the search to comments we need to add the -c (or --comment) switch:
seqfu grep -c -n extend file.fasta
Finally, regular expressions are supported only enabling -r (or --regex):
seqfu grep -r -n Seq_N..._ file.fasta
Matching patterns in DNA sequences
A simple text search (even with regular expressions) cannot be a handy way to identify matches in a DNA/RNA sequence.
Using the -o (--oligo) parameter, we scan the sequence for matches of oligonucleotides supporting IUPAC degenerate bases, supporting reverse complement matches and partial matches.
>Example
CAGATAAAA
if we scan for TTTT we will match the sequence, as it’s in the reverse complement strand:
seqfu grep -o TTTT file.fasta
We can also use IUPAC bases (N for any base, B for C, G or A…):
seqfu grep -o TTTTNT file.fasta