SeqFu Install

seqfu shred

Core since v1.4

Systematically tile sequences into single- or paired-end reads.

Invocation
seqfu shred
Input
FASTA, FASTQ
Output
FASTQ or FASTA
Paired-end
Supported
Also available as fu-shred (legacy binary accepting the same options).
Since 1.18 paired end support was enabled. Since 1.30 paired end output can be
compressed, interleaved or written to explicit files, and `fu-readtope` has been
replaced by `seqfu shred --amplicon`.

A program to systematically shotgun a reference (i.e. this does not simulate a random shotgun library preparation, but produce reads of length L sliding over the reference chromosomes at a step S).

This tool is to test the effect of read size alone on alignment and classification methods, and was introduced in SeqFu 1.4. The fu-shred binary is deprecated and forwards its arguments to seqfu shred.

Usage: seqfu shred [options] [<input>...]

  Systematically produce a "shotgun" of input sequences, as single-end or
  paired-end reads. Reads from STDIN if no input is given.

  Tiling:
    -l, --length INT           Read length [default: 100]
    -s, --step INT             Distance between consecutive segment starts [default: 10]
    -x, --coverage FLOAT       Target read coverage: computes --step (overrides -s)
    -f, --frag-len INT         Fragment (insert) length, paired-end only [default: 500]
    --frag-sd FLOAT            Standard deviation of the fragment length, paired-end
                               only; 0 keeps the tiling systematic [default: 0]
    --seed INT                 Random seed used with --frag-sd [default: 42]
    --tail                     Add a final segment anchored to the sequence end
    --circular                 Treat sequences as circular (segments wrap around)
    --amplicon                 Each input sequence is one fragment: R1 is the start,
                               R2 the reverse complement of the end
    --max-n FLOAT              Skip segments with a fraction of N above this [default: 1.0]

  Strand:
    -r, --add-rc               Reverse complement every other segment (= --strand alt)
    --strand STR               One of fwd, rev, alt, both [default: fwd]

  Output (single-end to STDOUT by default):
    -o, --out-prefix STR       Paired-end: write <STR><for-tag>.fq and <STR><rev-tag>.fq
    -1, --out-r1 FILE          Output file (single-end, or R1 with -2, or interleaved with -i)
    -2, --out-r2 FILE          Paired-end: R2 output file
    -i, --interleaved          Paired-end, interleaved (to STDOUT unless -1 is given)
    --for-tag STR              R1 tag used with --out-prefix [default: _R1]
    --rev-tag STR              R2 tag used with --out-prefix [default: _R2]

  Format:
    -q, --quality INT          Constant quality; -1 means FASTA output [default: 40]
    --fasta                    FASTA output (same as -q -1)
    -z, --gzip                 Compress output (implied by filenames ending in .gz)
    --level INT                Gzip compression level, 0-9 [default: 6]
    -t, --threads INT          Compression threads (uses pigz if available) [default: 1]

  Read names:
    -b, --basename             Prepend the file basename to the read name
    --split-basename STRING    Split the file basename at this character [default: .]
    --prefix-separator STRING  Join the basename with the rest of the read name with this [default: _]
    --pair-suffix              Append /1 and /2 to paired read names
    --coords                   Add the origin to the comment as seqname:start-end:strand

  Other:
    -v, --verbose              Verbose output
    -h, --help                 Show this help

Input

One or more FASTA or FASTQ files. By default will read from STDIN.

Parameters

Main parameters:

  • the desired read length with --length INT
  • the distance between the starting site of each segment, with --step INT, or a target read coverage with --coverage FLOAT (the step is then computed from the read length, counting both mates in paired end mode and both strands with --strand both)
  • the quality value of each base, with --quality INT (if you supply -1, or use --fasta, the output will be in FASTA format)

If processing multiple files, it can be convenient to prepend the file basename with --basename. The basename will be split at the first ., but this can be changed with --split-basename STR/CHAR.

Tiling

  • --tail adds one last segment ending exactly at the end of the sequence, so that the 3’ end is always covered.
  • --circular treats each sequence as circular (e.g. plasmids): segments start at every step along the whole sequence and wrap around the end.
  • --max-n FLOAT skips segments with a fraction of N bases above the threshold.
  • --amplicon treats each input sequence as a single fragment: in paired end mode R1 is the first --length bases and R2 the reverse complement of the last --length bases (sequences shorter than the read length are reported in full). This replaces the old fu-readtope script.

Strand

By default all segments are taken from the forward strand. --strand rev reverse complements all of them, --strand alt (or the legacy --add-rc) reverse complements every other segment, and --strand both emits each segment in both orientations (doubling the output).

Paired end mode

Paired end mode is enabled by any of:

  • --out-prefix STR: writes STR_R1.fq and STR_R2.fq (tags can be changed with --for-tag and --rev-tag; the extension becomes .fa in FASTA mode and gets a .gz suffix with --gzip)
  • -1 FILE -2 FILE: explicit output files, compressed when the name ends in .gz (or with --gzip)
  • --interleaved: a single interleaved stream, to STDOUT or to the file given with -1

The program first extracts a fragment of --frag-len bases, then the first --length bases are used as the first read, and the reverse complement of the last --length bases as the second read. Both mates share the same name, unless --pair-suffix is used to append /1 and /2.

With --frag-sd FLOAT the fragment length is drawn, for each fragment, from a normal distribution centred on --frag-len (never shorter than the read length). The random generator is seeded with --seed (default 42), so the output is reproducible. With the default --frag-sd 0 the tiling is fully systematic.

In single end mode, -1 FILE writes to a file instead of STDOUT; --gzip also works on STDOUT.

Ground truth

--coords adds the origin of each read to its comment as seqname:start-end:strand (1-based, inclusive; in paired end mode both mates carry the coordinates of the fragment). In circular mode a wrapping segment has an end smaller than its start.

Output

The generated sequences will be printed to the standard output (STDOUT). Each read has a progressive name generated like this:

  • file basename (if --basename is specified)
  • a string separator (if --basename is specified)
  • the chromosome name
  • a string separator
  • a progressive number
@k141_1_1 
GTCGGAGTCGTTTATCCGCAACATCCTGCTTGCACAGGAGTTTTATAAAAAGGAGTTCGGCATCAAGTCGAAGGATATGTTCCTGCCCGACTGCTTCGGA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@k141_1_2 
TCGGGCAGGAACATATCCTTCGACTTGATGCCGAACTCCTTTTTATAAAACTCCTGTGCAAGCAGGATGTTGCGGATAAACGACTCCGACGACGGCATGT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@k141_1_3 
AACGACCCGAACATGCCGTCGTCGGAGTCGTTTATCCGCAACATCCTGCTTGCACAGGAGTTTTATAAAAAGGAGTTCGGCATCAAGTCGAAGGATATGT
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@k141_1_4 
CGACTTGATGCCGAACTCCTTTTTATAAAACTCCTGTGCAAGCAGGATGTTGCGGATAAACGACTCCGACGACGGCATGTTCGGGTCGTTGGCCTCGAAC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@k141_1_5 
CGGGGGCTTCGTTCGAGGCCAACGACCCGAACATGCCGTCGTCGGAGTCGTTTATCCGCAACATCCTGCTTGCACAGGAGTTTTATAAAAAGGAGTTCGG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

Shotgun simulation

If you need to simulate a whole genome shotun, you will need alternative software like ART.